- Country: Macedonia
- Summary: Chemicals and Consumables
- MKT Ref No: 127405133
- Deadline: 13 Oct 2025
- Financier: Self Financed
- Purchaser Ownership: Government
- Tender Value: Refer Document
- Notice Type: Tender
- Document Ref. No.: 17835/2025
- Purchaser's Detail:Login to see full purchaser details. Login to see full purchaser details. Login to see full purchaser details. Login to see full purchaser details. Login to see full purchaser details. Login to see full purchaser details. Login to see full purchaser details. Login to see full purchaser details. Login to see full purchaser details.
- Description:
- Chloroform commercial β₯98%, packaging of a maximum of 1000 ml of Liquid, acetylthiocholine iodide β₯99.0% (AT) packaging of a maximum of 1 g of Obcystalic, potassium iodide, β₯95.0%, packaging of 250 g, form Solid, trifenilphin refinus. Reagent, P.A. Lacquer Dehydrogenase Activity After Optical Test in UV Area for a minimum of 100 analyzes - LDH Assay Kit, Set to Determine Activity succinate Dehydrogenase by colorimetric method for at least 100 analyzes - SDH Assay Kit, set of glutathione S Transferase with colorimetric method for at least 100 analyzes - GST Assay Kit, ethanol 96% LIQUID, Chelex(r) form Solid, DDH2O without nuclear, nuclear, K form Solid, 10 x PCR PUFER +/- MGCLβ Form Liquid, DNTP Mix for PCR ReadyMix LCO1490 Form Liquid, Preamer HC02198 Liquid, Primer MLCOIINTF SO Illumina NapaΕ‘ka na 5 'Krajot (Prijmer Primer Liquid -shaped, Primer JGHCO2198 with ilumina tail at 5 'end (rear primer tail GTCTCGTGGGGGGAGAGTGTGTAAGAGAG) LIQUID, Etidium Bromid Liquid, Agar, Puriss, Packing from 500 to 1000 g Solid, about...
- Documents:
If you are registered member, kindly login to view full details of this tender notice:
CLICK HERE TO LOGINChemicals and Consumables - Macedonia Tender
The FACULTY OF NATURAL SCIENCES AND MATHEMATICS, a Government sector organization in Macedonia, has announced a new tender for Chemicals and Consumables. This tender is published on MacedoniaTenders under MKT Ref No: 127405133 and is categorized as a Tender. Interested and eligible suppliers are invited to participate by reviewing the tender documents and submitting their bids before the deadline on 2025-10-13.
The estimated tender value is Refer Document, and full details, including technical specifications and submission requirements, are provided in the official tender documents. Ensure all submissions meet the criteria outlined to be considered for evaluation.
